ID: 925614331

View in Genome Browser
Species Human (GRCh38)
Location 2:5731242-5731264
Sequence GGAGGAGGAAACAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614331_925614342 3 Left 925614331 2:5731242-5731264 CCTGGTTCCCTGTTTCCTCCTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614331_925614343 14 Left 925614331 2:5731242-5731264 CCTGGTTCCCTGTTTCCTCCTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614331_925614340 -1 Left 925614331 2:5731242-5731264 CCTGGTTCCCTGTTTCCTCCTCC No data
Right 925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614331 Original CRISPR GGAGGAGGAAACAGGGAACC AGG (reversed) Intergenic
No off target data available for this crispr