ID: 925614333

View in Genome Browser
Species Human (GRCh38)
Location 2:5731249-5731271
Sequence TCCTAGGGGAGGAGGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614333_925614340 -8 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
925614333_925614342 -4 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614333_925614343 7 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614333_925614344 28 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614333 Original CRISPR TCCTAGGGGAGGAGGAAACA GGG (reversed) Intergenic