ID: 925614334

View in Genome Browser
Species Human (GRCh38)
Location 2:5731250-5731272
Sequence CTCCTAGGGGAGGAGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614334_925614342 -5 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614334_925614344 27 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614334_925614343 6 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614334_925614340 -9 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614334 Original CRISPR CTCCTAGGGGAGGAGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr