ID: 925614336

View in Genome Browser
Species Human (GRCh38)
Location 2:5731257-5731279
Sequence CTTACACCTCCTAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614336_925614343 -1 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614336_925614344 20 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614336_925614346 29 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614336_925614345 28 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614345 2:5731308-5731330 AAGCCACAGCTGTGGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614336 Original CRISPR CTTACACCTCCTAGGGGAGG AGG (reversed) Intergenic