ID: 925614339

View in Genome Browser
Species Human (GRCh38)
Location 2:5731264-5731286
Sequence CCTCAGACTTACACCTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614339_925614348 27 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614348 2:5731314-5731336 CAGCTGTGGTGACCAGGGACTGG No data
925614339_925614349 28 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614349 2:5731315-5731337 AGCTGTGGTGACCAGGGACTGGG No data
925614339_925614345 21 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614345 2:5731308-5731330 AAGCCACAGCTGTGGTGACCAGG No data
925614339_925614344 13 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614339_925614346 22 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614339_925614343 -8 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614339 Original CRISPR CCTCAGACTTACACCTCCTA GGG (reversed) Intergenic