ID: 925614341

View in Genome Browser
Species Human (GRCh38)
Location 2:5731265-5731287
Sequence TCCTCAGACTTACACCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614341_925614345 20 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614345 2:5731308-5731330 AAGCCACAGCTGTGGTGACCAGG 0: 1
1: 0
2: 2
3: 25
4: 258
925614341_925614344 12 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614341_925614343 -9 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614341_925614348 26 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614348 2:5731314-5731336 CAGCTGTGGTGACCAGGGACTGG No data
925614341_925614349 27 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614349 2:5731315-5731337 AGCTGTGGTGACCAGGGACTGGG 0: 1
1: 0
2: 5
3: 37
4: 499
925614341_925614346 21 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG 0: 1
1: 1
2: 15
3: 42
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614341 Original CRISPR TCCTCAGACTTACACCTCCT AGG (reversed) Intergenic