ID: 925614342

View in Genome Browser
Species Human (GRCh38)
Location 2:5731268-5731290
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614329_925614342 17 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614330_925614342 9 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614331_925614342 3 Left 925614331 2:5731242-5731264 CCTGGTTCCCTGTTTCCTCCTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614333_925614342 -4 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614334_925614342 -5 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type