ID: 925614343

View in Genome Browser
Species Human (GRCh38)
Location 2:5731279-5731301
Sequence GTCTGAGGAAGGATGTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614339_925614343 -8 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614337_925614343 -4 Left 925614337 2:5731260-5731282 CCTCCCCTAGGAGGTGTAAGTCT No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614336_925614343 -1 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614338_925614343 -7 Left 925614338 2:5731263-5731285 CCCCTAGGAGGTGTAAGTCTGAG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614334_925614343 6 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614333_925614343 7 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614329_925614343 28 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614331_925614343 14 Left 925614331 2:5731242-5731264 CCTGGTTCCCTGTTTCCTCCTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614341_925614343 -9 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614330_925614343 20 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614343 Original CRISPR GTCTGAGGAAGGATGTACAC TGG Intergenic
No off target data available for this crispr