ID: 925614344

View in Genome Browser
Species Human (GRCh38)
Location 2:5731300-5731322
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614339_925614344 13 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614337_925614344 17 Left 925614337 2:5731260-5731282 CCTCCCCTAGGAGGTGTAAGTCT No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614338_925614344 14 Left 925614338 2:5731263-5731285 CCCCTAGGAGGTGTAAGTCTGAG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614336_925614344 20 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614334_925614344 27 Left 925614334 2:5731250-5731272 CCTGTTTCCTCCTCCCCTAGGAG No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614333_925614344 28 Left 925614333 2:5731249-5731271 CCCTGTTTCCTCCTCCCCTAGGA No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data
925614341_925614344 12 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614344 2:5731300-5731322 GGATGTGAAAGCCACAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type