ID: 925614346

View in Genome Browser
Species Human (GRCh38)
Location 2:5731309-5731331
Sequence AGCCACAGCTGTGGTGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614339_925614346 22 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614341_925614346 21 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614338_925614346 23 Left 925614338 2:5731263-5731285 CCCCTAGGAGGTGTAAGTCTGAG No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614337_925614346 26 Left 925614337 2:5731260-5731282 CCTCCCCTAGGAGGTGTAAGTCT No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data
925614336_925614346 29 Left 925614336 2:5731257-5731279 CCTCCTCCCCTAGGAGGTGTAAG No data
Right 925614346 2:5731309-5731331 AGCCACAGCTGTGGTGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614346 Original CRISPR AGCCACAGCTGTGGTGACCA GGG Intergenic