ID: 925614349

View in Genome Browser
Species Human (GRCh38)
Location 2:5731315-5731337
Sequence AGCTGTGGTGACCAGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614338_925614349 29 Left 925614338 2:5731263-5731285 CCCCTAGGAGGTGTAAGTCTGAG No data
Right 925614349 2:5731315-5731337 AGCTGTGGTGACCAGGGACTGGG No data
925614341_925614349 27 Left 925614341 2:5731265-5731287 CCTAGGAGGTGTAAGTCTGAGGA No data
Right 925614349 2:5731315-5731337 AGCTGTGGTGACCAGGGACTGGG No data
925614339_925614349 28 Left 925614339 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
Right 925614349 2:5731315-5731337 AGCTGTGGTGACCAGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614349 Original CRISPR AGCTGTGGTGACCAGGGACT GGG Intergenic