ID: 925616166

View in Genome Browser
Species Human (GRCh38)
Location 2:5746366-5746388
Sequence GGAAAGCAACCTCCTAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925616166_925616171 18 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616171 2:5746407-5746429 CTATTCTTGGAAGGGCAGCCAGG No data
925616166_925616170 10 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616170 2:5746399-5746421 TCTTTAAGCTATTCTTGGAAGGG No data
925616166_925616168 5 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616168 2:5746394-5746416 TTTTCTCTTTAAGCTATTCTTGG No data
925616166_925616169 9 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG No data
925616166_925616172 23 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616172 2:5746412-5746434 CTTGGAAGGGCAGCCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925616166 Original CRISPR GGAAAGCAACCTCCTAACTG TGG (reversed) Intergenic
No off target data available for this crispr