ID: 925616169

View in Genome Browser
Species Human (GRCh38)
Location 2:5746398-5746420
Sequence CTCTTTAAGCTATTCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925616166_925616169 9 Left 925616166 2:5746366-5746388 CCACAGTTAGGAGGTTGCTTTCC No data
Right 925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG No data
925616165_925616169 16 Left 925616165 2:5746359-5746381 CCTGGAGCCACAGTTAGGAGGTT No data
Right 925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925616169 Original CRISPR CTCTTTAAGCTATTCTTGGA AGG Intergenic
No off target data available for this crispr