ID: 925616805

View in Genome Browser
Species Human (GRCh38)
Location 2:5751543-5751565
Sequence GGGCCATGAAACCTTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925616803_925616805 -7 Left 925616803 2:5751527-5751549 CCAGCAGGTGTCCAAGGGGCCAT No data
Right 925616805 2:5751543-5751565 GGGCCATGAAACCTTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925616805 Original CRISPR GGGCCATGAAACCTTTGTGC TGG Intergenic
No off target data available for this crispr