ID: 925619235

View in Genome Browser
Species Human (GRCh38)
Location 2:5774660-5774682
Sequence AAGAGCAGTTTCACTTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925619235_925619245 13 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619245 2:5774696-5774718 GGGGAAGAAGGCCCCTCCCAAGG No data
925619235_925619239 -9 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619239 2:5774674-5774696 ACTGCTCTTCCTCAGGTGGGAGG No data
925619235_925619244 1 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619244 2:5774684-5774706 CTCAGGTGGGAGGGGGAAGAAGG No data
925619235_925619242 -6 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619242 2:5774677-5774699 GCTCTTCCTCAGGTGGGAGGGGG No data
925619235_925619241 -7 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619241 2:5774676-5774698 TGCTCTTCCTCAGGTGGGAGGGG No data
925619235_925619240 -8 Left 925619235 2:5774660-5774682 CCAAAGAAAGTGAAACTGCTCTT No data
Right 925619240 2:5774675-5774697 CTGCTCTTCCTCAGGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925619235 Original CRISPR AAGAGCAGTTTCACTTTCTT TGG (reversed) Intergenic
No off target data available for this crispr