ID: 925625727

View in Genome Browser
Species Human (GRCh38)
Location 2:5840830-5840852
Sequence CAGGCACAGATAGGCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925625727_925625735 29 Left 925625727 2:5840830-5840852 CCCACGGAGCCTATCTGTGCCTG No data
Right 925625735 2:5840882-5840904 GCTTCCCTTAGAGCTGGTGCAGG No data
925625727_925625734 23 Left 925625727 2:5840830-5840852 CCCACGGAGCCTATCTGTGCCTG No data
Right 925625734 2:5840876-5840898 AGAAAAGCTTCCCTTAGAGCTGG No data
925625727_925625736 30 Left 925625727 2:5840830-5840852 CCCACGGAGCCTATCTGTGCCTG No data
Right 925625736 2:5840883-5840905 CTTCCCTTAGAGCTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925625727 Original CRISPR CAGGCACAGATAGGCTCCGT GGG (reversed) Intergenic
No off target data available for this crispr