ID: 925626510

View in Genome Browser
Species Human (GRCh38)
Location 2:5846733-5846755
Sequence TTCCTTCTCATTGCTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925626510_925626511 13 Left 925626510 2:5846733-5846755 CCATCTCTAGCAATGAGAAGGAA No data
Right 925626511 2:5846769-5846791 TAAGAACTACATTTCACCATTGG No data
925626510_925626512 21 Left 925626510 2:5846733-5846755 CCATCTCTAGCAATGAGAAGGAA No data
Right 925626512 2:5846777-5846799 ACATTTCACCATTGGAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925626510 Original CRISPR TTCCTTCTCATTGCTAGAGA TGG (reversed) Intergenic
No off target data available for this crispr