ID: 925627300

View in Genome Browser
Species Human (GRCh38)
Location 2:5853960-5853982
Sequence AGCTTCAGCAAGAAGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925627292_925627300 6 Left 925627292 2:5853931-5853953 CCTGCAGGGAGATGTACACCCCG No data
Right 925627300 2:5853960-5853982 AGCTTCAGCAAGAAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925627300 Original CRISPR AGCTTCAGCAAGAAGAGCTA GGG Intergenic
No off target data available for this crispr