ID: 925636679

View in Genome Browser
Species Human (GRCh38)
Location 2:5947842-5947864
Sequence TCCATCCAGAACCTCCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925636679_925636682 -4 Left 925636679 2:5947842-5947864 CCCTCACGGAGGTTCTGGATGGA No data
Right 925636682 2:5947861-5947883 TGGACAGTCGGTTAACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925636679 Original CRISPR TCCATCCAGAACCTCCGTGA GGG (reversed) Intergenic
No off target data available for this crispr