ID: 925638535

View in Genome Browser
Species Human (GRCh38)
Location 2:5965658-5965680
Sequence CAAAATGCCGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925638535_925638538 4 Left 925638535 2:5965658-5965680 CCCATATCACTATCGGCATTTTG No data
Right 925638538 2:5965685-5965707 AAGCCATTCAACAAGCCTCTAGG 0: 46
1: 1500
2: 1901
3: 1393
4: 857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925638535 Original CRISPR CAAAATGCCGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr