ID: 925640437

View in Genome Browser
Species Human (GRCh38)
Location 2:5981575-5981597
Sequence CGGGGATCACAGGATGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925640437_925640441 -5 Left 925640437 2:5981575-5981597 CCGGCAGCATCCTGTGATCCCCG No data
Right 925640441 2:5981593-5981615 CCCCGGAGAGATTTTTCATGAGG No data
925640437_925640445 8 Left 925640437 2:5981575-5981597 CCGGCAGCATCCTGTGATCCCCG No data
Right 925640445 2:5981606-5981628 TTTCATGAGGGCTGTATATTTGG No data
925640437_925640443 -4 Left 925640437 2:5981575-5981597 CCGGCAGCATCCTGTGATCCCCG No data
Right 925640443 2:5981594-5981616 CCCGGAGAGATTTTTCATGAGGG No data
925640437_925640447 25 Left 925640437 2:5981575-5981597 CCGGCAGCATCCTGTGATCCCCG No data
Right 925640447 2:5981623-5981645 ATTTGGAGAGAGAGAGGAAAAGG No data
925640437_925640446 19 Left 925640437 2:5981575-5981597 CCGGCAGCATCCTGTGATCCCCG No data
Right 925640446 2:5981617-5981639 CTGTATATTTGGAGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925640437 Original CRISPR CGGGGATCACAGGATGCTGC CGG (reversed) Intergenic
No off target data available for this crispr