ID: 925646740

View in Genome Browser
Species Human (GRCh38)
Location 2:6044207-6044229
Sequence CCTCGGGCTGCAGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925646740_925646747 6 Left 925646740 2:6044207-6044229 CCCCAGCACACTGCAGCCCGAGG No data
Right 925646747 2:6044236-6044258 GGCCAGACCGTTTGTTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925646740 Original CRISPR CCTCGGGCTGCAGTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr