ID: 925648945

View in Genome Browser
Species Human (GRCh38)
Location 2:6068360-6068382
Sequence GATTATGCACAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925648945_925648949 15 Left 925648945 2:6068360-6068382 CCCTGCTCCCTCTGTGCATAATC No data
Right 925648949 2:6068398-6068420 TTTCACATATTCTATACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925648945 Original CRISPR GATTATGCACAGAGGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr