ID: 925649845 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:6078227-6078249 |
Sequence | CTTCCCTCCCTTAGGTAACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925649840_925649845 | -10 | Left | 925649840 | 2:6078214-6078236 | CCATGCACAAGCCCTTCCCTCCC | No data | ||
Right | 925649845 | 2:6078227-6078249 | CTTCCCTCCCTTAGGTAACAGGG | No data | ||||
925649839_925649845 | -9 | Left | 925649839 | 2:6078213-6078235 | CCCATGCACAAGCCCTTCCCTCC | No data | ||
Right | 925649845 | 2:6078227-6078249 | CTTCCCTCCCTTAGGTAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925649845 | Original CRISPR | CTTCCCTCCCTTAGGTAACA GGG | Intergenic | ||
No off target data available for this crispr |