ID: 925649845

View in Genome Browser
Species Human (GRCh38)
Location 2:6078227-6078249
Sequence CTTCCCTCCCTTAGGTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925649840_925649845 -10 Left 925649840 2:6078214-6078236 CCATGCACAAGCCCTTCCCTCCC No data
Right 925649845 2:6078227-6078249 CTTCCCTCCCTTAGGTAACAGGG No data
925649839_925649845 -9 Left 925649839 2:6078213-6078235 CCCATGCACAAGCCCTTCCCTCC No data
Right 925649845 2:6078227-6078249 CTTCCCTCCCTTAGGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925649845 Original CRISPR CTTCCCTCCCTTAGGTAACA GGG Intergenic
No off target data available for this crispr