ID: 925650897

View in Genome Browser
Species Human (GRCh38)
Location 2:6087959-6087981
Sequence AAAACACACAAGCCACACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925650897_925650907 27 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650907 2:6088009-6088031 TTAAAAACGATGACTGGACAAGG No data
925650897_925650901 -6 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650901 2:6087976-6087998 TGTTTTGGAGAGTTAGGACTGGG No data
925650897_925650908 28 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650908 2:6088010-6088032 TAAAAACGATGACTGGACAAGGG No data
925650897_925650905 4 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650905 2:6087986-6088008 AGTTAGGACTGGGGGATCAAGGG No data
925650897_925650904 3 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650904 2:6087985-6088007 GAGTTAGGACTGGGGGATCAAGG No data
925650897_925650900 -7 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650900 2:6087975-6087997 GTGTTTTGGAGAGTTAGGACTGG No data
925650897_925650903 -4 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650903 2:6087978-6088000 TTTTGGAGAGTTAGGACTGGGGG No data
925650897_925650902 -5 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650902 2:6087977-6087999 GTTTTGGAGAGTTAGGACTGGGG No data
925650897_925650906 21 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650906 2:6088003-6088025 CAAGGGTTAAAAACGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925650897 Original CRISPR AAAACACACAAGCCACACTG TGG (reversed) Intergenic
No off target data available for this crispr