ID: 925650905

View in Genome Browser
Species Human (GRCh38)
Location 2:6087986-6088008
Sequence AGTTAGGACTGGGGGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925650897_925650905 4 Left 925650897 2:6087959-6087981 CCACAGTGTGGCTTGTGTGTTTT No data
Right 925650905 2:6087986-6088008 AGTTAGGACTGGGGGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925650905 Original CRISPR AGTTAGGACTGGGGGATCAA GGG Intergenic
No off target data available for this crispr