ID: 925651288 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:6092178-6092200 |
| Sequence | CTATTTGCCCAGAGTCAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925651288_925651291 | 9 | Left | 925651288 | 2:6092178-6092200 | CCATCCTGACTCTGGGCAAATAG | No data | ||
| Right | 925651291 | 2:6092210-6092232 | CAACTTAATTACATTTCAGTGGG | No data | ||||
| 925651288_925651290 | 8 | Left | 925651288 | 2:6092178-6092200 | CCATCCTGACTCTGGGCAAATAG | No data | ||
| Right | 925651290 | 2:6092209-6092231 | ACAACTTAATTACATTTCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925651288 | Original CRISPR | CTATTTGCCCAGAGTCAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||