ID: 925651288

View in Genome Browser
Species Human (GRCh38)
Location 2:6092178-6092200
Sequence CTATTTGCCCAGAGTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925651288_925651291 9 Left 925651288 2:6092178-6092200 CCATCCTGACTCTGGGCAAATAG No data
Right 925651291 2:6092210-6092232 CAACTTAATTACATTTCAGTGGG No data
925651288_925651290 8 Left 925651288 2:6092178-6092200 CCATCCTGACTCTGGGCAAATAG No data
Right 925651290 2:6092209-6092231 ACAACTTAATTACATTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925651288 Original CRISPR CTATTTGCCCAGAGTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr