ID: 925651290

View in Genome Browser
Species Human (GRCh38)
Location 2:6092209-6092231
Sequence ACAACTTAATTACATTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925651287_925651290 11 Left 925651287 2:6092175-6092197 CCTCCATCCTGACTCTGGGCAAA No data
Right 925651290 2:6092209-6092231 ACAACTTAATTACATTTCAGTGG No data
925651289_925651290 4 Left 925651289 2:6092182-6092204 CCTGACTCTGGGCAAATAGACTT No data
Right 925651290 2:6092209-6092231 ACAACTTAATTACATTTCAGTGG No data
925651288_925651290 8 Left 925651288 2:6092178-6092200 CCATCCTGACTCTGGGCAAATAG No data
Right 925651290 2:6092209-6092231 ACAACTTAATTACATTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925651290 Original CRISPR ACAACTTAATTACATTTCAG TGG Intergenic
No off target data available for this crispr