ID: 925657474

View in Genome Browser
Species Human (GRCh38)
Location 2:6165407-6165429
Sequence GGTTGGGCTTAGAAGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925657463_925657474 21 Left 925657463 2:6165363-6165385 CCGGGTGTATCACATGTTTGATT No data
Right 925657474 2:6165407-6165429 GGTTGGGCTTAGAAGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925657474 Original CRISPR GGTTGGGCTTAGAAGCTGGG GGG Intergenic
No off target data available for this crispr