ID: 925666531

View in Genome Browser
Species Human (GRCh38)
Location 2:6262930-6262952
Sequence CTCTGTGCAGGGTCGTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925666531_925666535 17 Left 925666531 2:6262930-6262952 CCATAGGACGACCCTGCACAGAG No data
Right 925666535 2:6262970-6262992 GTGTTTTTTGCCCCCCGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925666531 Original CRISPR CTCTGTGCAGGGTCGTCCTA TGG (reversed) Intergenic
No off target data available for this crispr