ID: 925666535

View in Genome Browser
Species Human (GRCh38)
Location 2:6262970-6262992
Sequence GTGTTTTTTGCCCCCCGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925666532_925666535 6 Left 925666532 2:6262941-6262963 CCCTGCACAGAGCTGACGTGATC No data
Right 925666535 2:6262970-6262992 GTGTTTTTTGCCCCCCGAGACGG No data
925666533_925666535 5 Left 925666533 2:6262942-6262964 CCTGCACAGAGCTGACGTGATCC No data
Right 925666535 2:6262970-6262992 GTGTTTTTTGCCCCCCGAGACGG No data
925666531_925666535 17 Left 925666531 2:6262930-6262952 CCATAGGACGACCCTGCACAGAG No data
Right 925666535 2:6262970-6262992 GTGTTTTTTGCCCCCCGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925666535 Original CRISPR GTGTTTTTTGCCCCCCGAGA CGG Intergenic
No off target data available for this crispr