ID: 925667881

View in Genome Browser
Species Human (GRCh38)
Location 2:6281015-6281037
Sequence ATCACTTACCTGGCCAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925667879_925667881 0 Left 925667879 2:6280992-6281014 CCTGATTAACTTTATTTATTTAC No data
Right 925667881 2:6281015-6281037 ATCACTTACCTGGCCAATTAAGG No data
925667878_925667881 19 Left 925667878 2:6280973-6280995 CCACTCTTTATTATTTATACCTG No data
Right 925667881 2:6281015-6281037 ATCACTTACCTGGCCAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925667881 Original CRISPR ATCACTTACCTGGCCAATTA AGG Intergenic
No off target data available for this crispr