ID: 925672391

View in Genome Browser
Species Human (GRCh38)
Location 2:6325398-6325420
Sequence GGTCTTCTACGCAGGAGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925672386_925672391 8 Left 925672386 2:6325367-6325389 CCACACATTCATTTGAAGGTAGG No data
Right 925672391 2:6325398-6325420 GGTCTTCTACGCAGGAGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925672391 Original CRISPR GGTCTTCTACGCAGGAGCTC CGG Intergenic
901385694 1:8907258-8907280 GGTCTTCAACTCCCGAGCTCAGG + Intergenic
905223271 1:36463678-36463700 GGTCTTTTGCTCAGGACCTCTGG + Intronic
906468124 1:46103351-46103373 GGTCTCCAACTCTGGAGCTCAGG - Intronic
908751054 1:67423388-67423410 GGTCTTCAACTCCTGAGCTCAGG - Intronic
910191200 1:84597791-84597813 GATGTTCTACTCAGGAGCCCTGG - Intergenic
914264611 1:146027651-146027673 GGTCTTGAACTCCGGAGCTCAGG - Intergenic
915004387 1:152623098-152623120 GGACATCTAGGCAGGAGGTCAGG + Exonic
916793787 1:168146968-168146990 GGTCTTCAACTCCTGAGCTCAGG - Intergenic
918044387 1:180932955-180932977 GGTCTTCAACTCCTGAGCTCAGG + Intronic
919080720 1:192862738-192862760 GGTCTTGAACTCATGAGCTCAGG - Intergenic
919605393 1:199676231-199676253 GGTCTTCAACTCCTGAGCTCAGG - Intergenic
919639538 1:200035332-200035354 GGTCATCTACCCAGGCGCGCGGG + Intronic
921615424 1:217260804-217260826 GGTCTTCTATCCAAGAGCTATGG - Intergenic
1066652994 10:37677349-37677371 GGACTTCAACACAGGAGTTCTGG + Intergenic
1067036543 10:42924816-42924838 GGACTTCAACGCAGGAATTCGGG + Intergenic
1069666020 10:70159475-70159497 GGTCTTCAACTCCTGAGCTCAGG - Intronic
1069711300 10:70490431-70490453 GGTCTTCAACTCCTGAGCTCAGG + Intronic
1074884551 10:117684091-117684113 GGTCTCCTGCGCTGGAGCGCCGG + Intergenic
1075467105 10:122659891-122659913 GGACTTGGATGCAGGAGCTCTGG - Intergenic
1076141010 10:128078473-128078495 GTTCTTCCAAGCAGGAGCTTGGG + Intronic
1081139210 11:39476616-39476638 GGTCTCAAACTCAGGAGCTCAGG + Intergenic
1083392652 11:62366041-62366063 GGTCTTCAACTCCTGAGCTCGGG - Intronic
1083395009 11:62384697-62384719 GGTCTTCAACTCCTGAGCTCGGG - Intronic
1083537277 11:63481221-63481243 GGTCTTGAACGCCTGAGCTCAGG - Intronic
1084012840 11:66362301-66362323 GGTGCTCTGCCCAGGAGCTCAGG + Intronic
1085470433 11:76754059-76754081 GGTCTCCAGCTCAGGAGCTCAGG + Intergenic
1086685665 11:89730555-89730577 TGGCTGCCACGCAGGAGCTCTGG + Intergenic
1094524326 12:31221696-31221718 GGTCTTCTTCCCGGGACCTCAGG - Intergenic
1099202880 12:79695440-79695462 GGTCTTCTAAACAGCAACTCTGG - Intergenic
1100258974 12:92913875-92913897 GGTCTTCAACTCATGACCTCAGG + Intronic
1102883017 12:116500555-116500577 GGTCTTGAACTCCGGAGCTCAGG - Intergenic
1113246801 13:108405322-108405344 GGCCTTCTGCCCAGGATCTCAGG - Intergenic
1113904676 13:113813637-113813659 GGCCTTCTGCCCAGGAGCGCTGG - Exonic
1115494571 14:33990257-33990279 GCTCTTGTACACAGGAACTCTGG + Intronic
1116501499 14:45629024-45629046 GGTCTTGGACGCCTGAGCTCAGG + Intergenic
1118661412 14:68017410-68017432 GGTCTTGAACTCCGGAGCTCAGG + Intronic
1119517759 14:75261654-75261676 GGTCTTGAACTCATGAGCTCAGG + Intronic
1122556169 14:102581547-102581569 GGTCTTCAACTCCTGAGCTCAGG + Intergenic
1126627689 15:50700838-50700860 GGTCTTCAACTCTTGAGCTCTGG - Intergenic
1126761034 15:51970373-51970395 GGTCTTCAACTCCTGAGCTCAGG + Intronic
1128794971 15:70459894-70459916 GGTCTTCTACTCTGGAGTCCAGG - Intergenic
1129523380 15:76199517-76199539 GGTCTTCTCTGCAGGAGCTGAGG - Intronic
1131049433 15:89336738-89336760 GGTCTTCAACTCCTGAGCTCAGG - Intergenic
1132596126 16:751131-751153 GGTCTTCAACACAGGAGCATGGG - Intronic
1133095663 16:3443474-3443496 GCTCCTTTACGCAGGAGCTGCGG + Exonic
1133130489 16:3673598-3673620 GGGCTCCCACGCAGGAGCCCTGG + Intronic
1134679070 16:16111245-16111267 GGTGTTCTACGTAGGAGCAAAGG + Intronic
1136354801 16:29737372-29737394 GGTCTTCAACTCCGGACCTCAGG - Intergenic
1137325427 16:47430280-47430302 GGTCTTGAACTCTGGAGCTCAGG + Intronic
1139634643 16:68250659-68250681 GGTCTTCAACTCCTGAGCTCAGG - Intronic
1141210278 16:81973339-81973361 GTTCTTCTACCCAGGATCTGAGG - Intergenic
1141936064 16:87238576-87238598 GGGCTTCAACGCAGGAACTTGGG + Intronic
1142019945 16:87775871-87775893 GGTCTTGAACGCCTGAGCTCAGG - Intergenic
1142165349 16:88583933-88583955 TGTCTGCCACGCAGGAACTCCGG - Intronic
1142776647 17:2145331-2145353 GGTCTTCAACTCCTGAGCTCAGG + Intronic
1144659689 17:17060103-17060125 GGCCATCTGCGCAGGAGGTCAGG - Intronic
1147000502 17:37359031-37359053 GTTCCTCCACGCAGGGGCTCCGG - Exonic
1148377125 17:47158834-47158856 GGTCTTGAACTCATGAGCTCTGG + Intronic
1149609586 17:57950367-57950389 GGTCTTCAACTCCTGAGCTCAGG + Intronic
1150378517 17:64702015-64702037 GGTCTTGAACTCATGAGCTCAGG - Intergenic
1152319819 17:79602458-79602480 GGTCTTCTCCCCAGCAGCTGGGG + Intergenic
1153995104 18:10433924-10433946 GGTCTTGTACTCCTGAGCTCAGG - Intergenic
1161583353 19:5092471-5092493 GTTCTGCTGCCCAGGAGCTCCGG + Intronic
1163536376 19:17879074-17879096 GGTCTTCAACTCATGACCTCAGG - Intronic
1164736251 19:30543575-30543597 GCTCTTCTACCCAAGCGCTCTGG - Intronic
1165502315 19:36199730-36199752 GGTCTTGTACTCCTGAGCTCAGG + Intronic
1165551735 19:36592375-36592397 GGTCTTGAACTCCGGAGCTCAGG - Intronic
1165840040 19:38783263-38783285 GGTCTTGAACTCTGGAGCTCAGG + Intergenic
1166320318 19:42014175-42014197 GGTCTTGAACTCTGGAGCTCAGG - Intronic
1167815954 19:51881262-51881284 GGTCTTGAACTCTGGAGCTCAGG - Intronic
925672391 2:6325398-6325420 GGTCTTCTACGCAGGAGCTCCGG + Intergenic
925680022 2:6410727-6410749 GGTCAGGTACGCAGGAGCTCAGG + Intergenic
927412930 2:22847120-22847142 GTTTTTATAAGCAGGAGCTCAGG + Intergenic
927627119 2:24733525-24733547 GGTCTTGAACTCCGGAGCTCAGG - Intronic
929899424 2:45988142-45988164 GGCCTGCTAGGCTGGAGCTCTGG + Intronic
930123936 2:47782263-47782285 GGTCTTCAACGCCTGACCTCAGG + Intronic
941292952 2:163698555-163698577 GGTGTTCTACTCTGTAGCTCTGG - Intronic
943134921 2:183897994-183898016 GGTGTTCTAACCAGGAGCCCAGG + Intergenic
943703533 2:191012194-191012216 GGTCTTGAACTCCGGAGCTCAGG - Intronic
947934347 2:233990691-233990713 GGTGTTCTAACCACGAGCTCAGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1173605446 20:44327774-44327796 GGTCTTCAACTCCTGAGCTCAGG + Intergenic
1174416005 20:50367731-50367753 GTGCATCTACTCAGGAGCTCAGG - Intergenic
1174628256 20:51933749-51933771 GGTCTCCTACACCTGAGCTCAGG + Intergenic
1175777061 20:61660077-61660099 GGTCTTCCACCCCGGAGCTAAGG + Intronic
1175792361 20:61748064-61748086 TGACTTCTCCGCAGGAGCTGGGG + Intronic
1179209665 21:39314005-39314027 GGTCCTCTACGCGGGACCGCAGG + Intronic
1179348097 21:40580314-40580336 GGTCTTCAACTCATGACCTCAGG - Intronic
1179633554 21:42693132-42693154 GGCATTCTCTGCAGGAGCTCAGG - Intronic
1180047081 21:45311997-45312019 GGTCTTCAACCCCGGAGCACAGG + Intergenic
1180893561 22:19310176-19310198 GGTCTTGAACGCCTGAGCTCAGG + Intergenic
1181156724 22:20926893-20926915 GGTCTCGAACGCATGAGCTCAGG - Intronic
1182086513 22:27564783-27564805 GGTCTGCTTGGCAGGAGCTGTGG - Intergenic
1183152851 22:36051656-36051678 GGTCTTCTACTCCTGACCTCAGG - Intergenic
1183634867 22:39055286-39055308 GGTCTTGAACTCATGAGCTCAGG + Intronic
951556754 3:23928773-23928795 GGTCTTGTACTCCTGAGCTCAGG - Intronic
953625059 3:44563846-44563868 GCTCTTCAATACAGGAGCTCTGG - Intronic
954449987 3:50566676-50566698 GGGCTTCTCCGCAGGCTCTCGGG + Intronic
963138509 3:141929226-141929248 GGTCCTCTATGCAGGGCCTCAGG - Intergenic
967421851 3:189282095-189282117 GGTCTTGAACTCATGAGCTCAGG + Intronic
969391590 4:6894907-6894929 CTGCTTCTCCGCAGGAGCTCAGG - Intergenic
971319550 4:25594347-25594369 GGTCTTCAAGCCTGGAGCTCAGG - Intergenic
972487413 4:39555447-39555469 GGTCTTGAACACCGGAGCTCAGG + Intronic
973710319 4:53623448-53623470 GGTCTTGAACACATGAGCTCAGG + Intronic
975469361 4:74747425-74747447 GGTCCCCTAGGCAGGAGCTGTGG - Intronic
982727536 4:158921220-158921242 GGTCTTGTACTCCGGACCTCTGG - Intronic
983903105 4:173157893-173157915 GGTCTTGAACTCATGAGCTCAGG - Intergenic
987677186 5:21089653-21089675 GGTCTTGAACTCAGGACCTCAGG + Intergenic
995591259 5:113702317-113702339 GGTCTTGTACTCCTGAGCTCAGG - Intergenic
997160495 5:131604085-131604107 GGTTTTCTCCACAGGAGCTTAGG + Intronic
997803707 5:136892138-136892160 GGTCTGACATGCAGGAGCTCTGG - Intergenic
998885997 5:146694038-146694060 GATCTTCTAAGCAGGAGATGTGG + Intronic
1000430698 5:161148747-161148769 GGTCTTCTAATCAGTAGCTTGGG - Intergenic
1002691435 5:181053212-181053234 GCTCTTCCACGCAGAGGCTCCGG - Exonic
1003364688 6:5461254-5461276 GGTCTTGAACACCGGAGCTCAGG + Intronic
1003979135 6:11373354-11373376 TGTCTTCTACTGAGGACCTCAGG - Intronic
1004893782 6:20127217-20127239 GGTCTGTTACTCAGGAACTCAGG - Intronic
1006821371 6:36898493-36898515 GGTCTTAAACGCCGGACCTCAGG + Intronic
1014563546 6:122919737-122919759 GGTATTATACTCAGGAACTCAGG - Intergenic
1019322204 7:420872-420894 GGGCTTCTCTGCAGGGGCTCCGG + Intergenic
1020403491 7:7804454-7804476 GGTCTTGAACTCCGGAGCTCAGG - Intronic
1023953154 7:44863967-44863989 GGTCTTCAACTCCTGAGCTCAGG + Intergenic
1024881014 7:54085323-54085345 GGTCTTGAACTCAGGACCTCAGG - Intergenic
1025634276 7:63307791-63307813 GGTCTTCAACTCATGACCTCAGG - Intergenic
1025648422 7:63440375-63440397 GGTCTTCAACTCATGACCTCAGG + Intergenic
1034882595 7:154773941-154773963 GGGCTTCTGTGCAGGAGCTCAGG - Intronic
1039709043 8:40037137-40037159 GGTCTTGAACTCATGAGCTCAGG - Intergenic
1039814302 8:41079311-41079333 GATCTTCTAACCAGGAGCCCAGG + Intergenic
1041111585 8:54487984-54488006 GGTTTTCTCCCCAGGGGCTCTGG + Intergenic
1045704896 8:104911029-104911051 GTTCCTCTACTCAGGATCTCAGG - Intronic
1045861415 8:106818558-106818580 AGTCTTCTACCCAGGAAGTCAGG + Intergenic
1049510075 8:143022838-143022860 GGGCTCCCACGCAGAAGCTCTGG + Intronic
1056565768 9:87771333-87771355 GGTCCTCTAGGCAGGCGCGCCGG + Intergenic
1058927115 9:109677449-109677471 GGTCTTCAACTCCTGAGCTCAGG - Intronic
1059661511 9:116406416-116406438 TGTTTTCTACTCAGGGGCTCTGG - Intergenic
1187161594 X:16770200-16770222 GGTCTTCAACTCCTGAGCTCAGG - Intergenic
1190624918 X:52327845-52327867 GGTCTTGAACTCATGAGCTCAGG + Intergenic