ID: 925678988

View in Genome Browser
Species Human (GRCh38)
Location 2:6396852-6396874
Sequence AGAGCTGCCATGTAAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925678988_925678991 12 Left 925678988 2:6396852-6396874 CCTGCTTCTTACATGGCAGCTCT No data
Right 925678991 2:6396887-6396909 CTCCCTCACAACTAGTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925678988 Original CRISPR AGAGCTGCCATGTAAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr