ID: 925679008

View in Genome Browser
Species Human (GRCh38)
Location 2:6397168-6397190
Sequence TTGGATACACAGAGATACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925679008_925679011 1 Left 925679008 2:6397168-6397190 CCCTGGTATCTCTGTGTATCCAA No data
Right 925679011 2:6397192-6397214 TTTCTCTTTTTATAATGACTTGG No data
925679008_925679012 16 Left 925679008 2:6397168-6397190 CCCTGGTATCTCTGTGTATCCAA No data
Right 925679012 2:6397207-6397229 TGACTTGGTCAGATTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925679008 Original CRISPR TTGGATACACAGAGATACCA GGG (reversed) Intergenic
No off target data available for this crispr