ID: 925681414

View in Genome Browser
Species Human (GRCh38)
Location 2:6425623-6425645
Sequence GGAGCCAGAGGAGGAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925681414_925681418 -5 Left 925681414 2:6425623-6425645 CCTGTGCTTCCTCCTCTGGCTCC No data
Right 925681418 2:6425641-6425663 GCTCCCTTTCAGCCACACCTGGG No data
925681414_925681425 22 Left 925681414 2:6425623-6425645 CCTGTGCTTCCTCCTCTGGCTCC No data
Right 925681425 2:6425668-6425690 CCTCCCTCCCCAGCATTTCAGGG No data
925681414_925681417 -6 Left 925681414 2:6425623-6425645 CCTGTGCTTCCTCCTCTGGCTCC No data
Right 925681417 2:6425640-6425662 GGCTCCCTTTCAGCCACACCTGG No data
925681414_925681423 21 Left 925681414 2:6425623-6425645 CCTGTGCTTCCTCCTCTGGCTCC No data
Right 925681423 2:6425667-6425689 TCCTCCCTCCCCAGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925681414 Original CRISPR GGAGCCAGAGGAGGAAGCAC AGG (reversed) Intergenic
No off target data available for this crispr