ID: 925682610

View in Genome Browser
Species Human (GRCh38)
Location 2:6438712-6438734
Sequence CAGTAAATACAGATGCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925682610_925682611 20 Left 925682610 2:6438712-6438734 CCAAGTGGCATCTGTATTTACTG No data
Right 925682611 2:6438755-6438777 TGTTTTATGTCATTTTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925682610 Original CRISPR CAGTAAATACAGATGCCACT TGG (reversed) Intergenic
No off target data available for this crispr