ID: 925691683

View in Genome Browser
Species Human (GRCh38)
Location 2:6530727-6530749
Sequence CAGGGAAGGCAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925691683_925691688 10 Left 925691683 2:6530727-6530749 CCTTCTTCCTTCTGCCTTCCCTG No data
Right 925691688 2:6530760-6530782 ATCCACTTCAAGCTCTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925691683 Original CRISPR CAGGGAAGGCAGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr