ID: 925695534

View in Genome Browser
Species Human (GRCh38)
Location 2:6573898-6573920
Sequence CAGGGCCAACTTAAGTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925695531_925695534 17 Left 925695531 2:6573858-6573880 CCTAGAAAACTACTTAATAACTA No data
Right 925695534 2:6573898-6573920 CAGGGCCAACTTAAGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925695534 Original CRISPR CAGGGCCAACTTAAGTAAAT TGG Intergenic
No off target data available for this crispr