ID: 925702829

View in Genome Browser
Species Human (GRCh38)
Location 2:6656111-6656133
Sequence CGTGCTTGCCTGGAACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925702829_925702833 0 Left 925702829 2:6656111-6656133 CCTTGAGGTTCCAGGCAAGCACG No data
Right 925702833 2:6656134-6656156 GCCCCAGGTATTGCAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925702829 Original CRISPR CGTGCTTGCCTGGAACCTCA AGG (reversed) Intergenic
No off target data available for this crispr