ID: 925705107

View in Genome Browser
Species Human (GRCh38)
Location 2:6677286-6677308
Sequence TGCTTCTGGATTGAATCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925705107_925705112 7 Left 925705107 2:6677286-6677308 CCCTAAGATTCAATCCAGAAGCA No data
Right 925705112 2:6677316-6677338 TCAGAGTTACAACAAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925705107 Original CRISPR TGCTTCTGGATTGAATCTTA GGG (reversed) Intergenic
No off target data available for this crispr