ID: 925708416

View in Genome Browser
Species Human (GRCh38)
Location 2:6713398-6713420
Sequence TTTCCTGGAGTCGCTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925708416_925708423 5 Left 925708416 2:6713398-6713420 CCAGAGGCAGCGACTCCAGGAAA No data
Right 925708423 2:6713426-6713448 TTGGAAGGTGGTTTCCCAGCTGG No data
925708416_925708424 6 Left 925708416 2:6713398-6713420 CCAGAGGCAGCGACTCCAGGAAA No data
Right 925708424 2:6713427-6713449 TGGAAGGTGGTTTCCCAGCTGGG No data
925708416_925708419 -10 Left 925708416 2:6713398-6713420 CCAGAGGCAGCGACTCCAGGAAA No data
Right 925708419 2:6713411-6713433 CTCCAGGAAAAGGCCTTGGAAGG No data
925708416_925708425 7 Left 925708416 2:6713398-6713420 CCAGAGGCAGCGACTCCAGGAAA No data
Right 925708425 2:6713428-6713450 GGAAGGTGGTTTCCCAGCTGGGG No data
925708416_925708421 -7 Left 925708416 2:6713398-6713420 CCAGAGGCAGCGACTCCAGGAAA No data
Right 925708421 2:6713414-6713436 CAGGAAAAGGCCTTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925708416 Original CRISPR TTTCCTGGAGTCGCTGCCTC TGG (reversed) Intergenic
No off target data available for this crispr