ID: 925709959

View in Genome Browser
Species Human (GRCh38)
Location 2:6729246-6729268
Sequence TTGCTATTGTGACCTAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925709959 Original CRISPR TTGCTATTGTGACCTAACTC AGG (reversed) Intergenic
900851789 1:5149524-5149546 GTGCCATTATGACCTAATTCAGG - Intergenic
905305116 1:37012466-37012488 TTGCAATTGTGACCTTGCACAGG - Intronic
906258363 1:44367769-44367791 TTGCCACACTGACCTAACTCCGG + Intergenic
906541845 1:46592860-46592882 TTGTTATGGTGACCTGACTTTGG - Intronic
911022136 1:93399764-93399786 TTGCTATTTTGGCCTATTTCTGG - Intergenic
917965944 1:180178599-180178621 TTGCTCTTGTTATCTAACCCTGG - Intronic
918903002 1:190450192-190450214 TTGCTATTAGGATCCAACTCTGG + Intronic
920885172 1:209920101-209920123 TTGCTATTCAGAGCTAACCCAGG + Intergenic
923167915 1:231384835-231384857 CTGCTTTTGTGCCCCAACTCCGG + Intronic
1064010165 10:11729332-11729354 TTGCTATTGTAACCTAACCCAGG - Intergenic
1064793499 10:18986487-18986509 TTGCTTTTGTGACAGTACTCAGG - Intergenic
1065779081 10:29150177-29150199 TTGGCAACGTGACCTAACTCAGG - Intergenic
1072315922 10:94202983-94203005 TAGCTATTATCACCTAAGTCAGG - Intronic
1075495080 10:122912924-122912946 TTGCTGTTGTGACATAAATGAGG + Exonic
1079492962 11:21010010-21010032 TTGCTATTCTGGCTTAACCCAGG + Intronic
1082963838 11:58945372-58945394 TTGCTCTTGTGACCCCACCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1103246713 12:119464278-119464300 TTGCTCTTGCAACCCAACTCTGG - Intronic
1103246797 12:119464808-119464830 TTGCTCTTGCAACCCAACTCTGG + Intronic
1107696679 13:43007337-43007359 TTGATATTGTGACCAAATGCAGG + Intergenic
1112639357 13:101255451-101255473 TTGCTTTTGTGATCTAGCACAGG - Intronic
1113988606 13:114340235-114340257 TTGGTTTTTTGACCTAACCCTGG - Intergenic
1114140655 14:19906207-19906229 TTATTATTGTGACCTTACTTTGG + Intergenic
1115098648 14:29671197-29671219 TTGCTATTGTGTTCTCAGTCTGG - Intronic
1117746170 14:58871735-58871757 TTATGATTGTGACCTCACTCGGG + Intergenic
1118699485 14:68419276-68419298 TTGCTATTTTCACTTTACTCTGG + Intronic
1124907929 15:33889028-33889050 TTGCTATTTTCATATAACTCAGG + Intronic
1133525486 16:6601398-6601420 TTGGTATTGTGGCCAGACTCCGG + Intronic
1138092143 16:54183650-54183672 TTGCTATTGTGAAATAGCTGTGG + Intergenic
1138314036 16:56052986-56053008 TTGCTATTCTGAACAAAATCAGG + Intergenic
1138615741 16:58164645-58164667 TTCCTAATTTGATCTAACTCGGG + Intronic
1146636519 17:34510193-34510215 TTACTATGGTGACCTACCACAGG + Intergenic
1155825108 18:30431724-30431746 TTGCTTCTGTCACCTAATTCAGG - Intergenic
1163782205 19:19256556-19256578 TTGCCATGGTGACCAAACTCTGG - Exonic
1164078980 19:21846318-21846340 TGGTCATTGTGACATAACTCTGG - Intronic
1164120021 19:22257601-22257623 TTGCTATTGTGACATGTGTCTGG - Intergenic
1164228187 19:23264580-23264602 TAGAGATTGTGACCTATCTCTGG - Intergenic
924959184 2:18551-18573 TTGGTTTTTTGACCTAACCCTGG + Intergenic
925709959 2:6729246-6729268 TTGCTATTGTGACCTAACTCAGG - Intergenic
926531761 2:14055884-14055906 TGGCTATTGTCACCTAACTTGGG + Intergenic
934753953 2:96812332-96812354 TGGGTATAGTGACGTAACTCAGG - Intergenic
937733879 2:125266208-125266230 TTTCTATTTTAACCTAACTGAGG - Intergenic
943646998 2:190417311-190417333 TTGCTACTGTGACCTTGCTAAGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
948602707 2:239116370-239116392 TGGCTATTGGGACCTCTCTCTGG + Intronic
1169535958 20:6540636-6540658 TTGTTATTGGGGCCTAATTCTGG + Intergenic
1172615403 20:36280152-36280174 TCGCTTTTATGACCTAACTTTGG + Intergenic
1177125406 21:17187266-17187288 TTGCTTTTGTGTTCTAAGTCAGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180598307 22:16994646-16994668 TTGCTATATTCACCTAGCTCTGG + Intronic
1181939612 22:26464958-26464980 TTACTCTTGTGATTTAACTCTGG - Intronic
951318861 3:21220732-21220754 TTGGTTTTGTGAGCTCACTCAGG - Intergenic
951998576 3:28758596-28758618 CTGCCATTGTGTTCTAACTCTGG + Intergenic
952093258 3:29917241-29917263 TTGCTATTTTTACCAAAATCTGG - Intronic
955146846 3:56328110-56328132 GTGCTATAGTAACCTAAGTCAGG + Intronic
957739518 3:84246659-84246681 ATCATATTGTGACCTATCTCAGG + Intergenic
958032257 3:88125987-88126009 TTACTATTGTAACCTAAGTAGGG - Intronic
958962904 3:100527171-100527193 TATCTATTGTGCACTAACTCTGG - Intronic
968206990 3:196811675-196811697 TTGCTTTTGTGACTCAACACTGG - Intronic
968374660 4:29000-29022 TTGGTTTTCTGACCTAACCCTGG + Intergenic
973896613 4:55420218-55420240 TTACTATTGAGTCCCAACTCTGG - Intronic
974482467 4:62463891-62463913 TTGATATTCTGTCCTAATTCTGG + Intergenic
976653647 4:87463414-87463436 TTGCTATTTTGAACCAACTAGGG - Intergenic
978696912 4:111592552-111592574 TTGGTATAGTGTTCTAACTCAGG - Intergenic
981034987 4:140160241-140160263 TTGGTCTTGGGACCTAACACAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982162297 4:152582535-152582557 TTGCTATTGTGAATTCACTGTGG - Intergenic
985310768 4:188595682-188595704 TTGCTATTGGGAACTAAGTGAGG + Intergenic
987411274 5:17617260-17617282 TAGCTATTGTGACTTAACATGGG + Intergenic
987413701 5:17640576-17640598 TAGCTATTGTGAATTAACTTGGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987822800 5:22987463-22987485 TTTCTGTTGTGACCTACCACAGG - Intergenic
990684026 5:58279107-58279129 TTGCTATAGTGATCCATCTCAGG - Intergenic
995680367 5:114711305-114711327 TTGCTTTTGTGACCTAGCGCTGG - Intergenic
996852772 5:127971072-127971094 ATGTTCTTGTGACCTAATTCAGG - Intergenic
1001690502 5:173629362-173629384 TTGCTATTGTTCCCTACCTTGGG - Intergenic
1002755644 6:157060-157082 TTGGTCTTCTGACCTAACCCTGG + Intergenic
1008189389 6:48436294-48436316 TTTCTATGCTAACCTAACTCAGG - Intergenic
1010626951 6:78149023-78149045 TTTCTCTTGTGAAATAACTCAGG - Intergenic
1012024004 6:93965224-93965246 TTGCTATTTCCACCTAACTCAGG + Intergenic
1020123265 7:5517685-5517707 TTGCTATTGGGGCCTAATTCTGG + Intergenic
1021354998 7:19643403-19643425 TTGCTATTGTTTACCAACTCTGG - Intergenic
1024148311 7:46540022-46540044 TGGCTATTGTAAGCAAACTCAGG - Intergenic
1025161734 7:56667126-56667148 TGGCAATTGTGACATATCTCTGG + Intergenic
1025745756 7:64241371-64241393 TGGCAATTGTGACATATCTCTGG - Intronic
1025745809 7:64241684-64241706 TTGGGATTGTGACCTATCACTGG - Intronic
1025785906 7:64643108-64643130 GGGCTATTGTGACATATCTCTGG + Intergenic
1027416557 7:77980554-77980576 TTGCCATCATGACCTCACTCTGG + Intergenic
1028063164 7:86346929-86346951 TTGTTGTTGTTACCTAACTGAGG + Intergenic
1030770442 7:113468578-113468600 TTTAGATTGTTACCTAACTCTGG + Intergenic
1032976478 7:137229954-137229976 TTTCAACTGAGACCTAACTCTGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037455853 8:19063362-19063384 TTGCTATTCTGTACTACCTCTGG - Intronic
1037673585 8:21036002-21036024 TTGCTATTGTGACTGAGCTGGGG - Intergenic
1042866067 8:73357626-73357648 TTGTTATTTTGAGCTAACTGAGG + Intergenic
1052157727 9:25215476-25215498 TGGCTATTTTGGCCTAACTTTGG - Intergenic
1055825974 9:80325268-80325290 TTCTTATTGTCACATAACTCAGG + Intergenic
1058594838 9:106604620-106604642 TTGAAATTGTCACCTAACTTGGG - Intergenic
1060290260 9:122295850-122295872 TTGCTTTTTTGCCTTAACTCTGG + Intronic
1060676931 9:125523737-125523759 TTGCCTTTGTGATCTAACCCTGG + Intronic
1203574560 Un_KI270744v1:165151-165173 TTGGTTTTCTGACCTAACCCTGG - Intergenic
1188530182 X:31131881-31131903 TTGCTACTTTCAGCTAACTCAGG - Intronic
1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG + Intronic
1197595315 X:128457033-128457055 TTGCTATTTTCACCTATCTTGGG + Intergenic