ID: 925711835

View in Genome Browser
Species Human (GRCh38)
Location 2:6748635-6748657
Sequence TAGTTACAGCAGGTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925711835_925711842 -5 Left 925711835 2:6748635-6748657 CCCTGTTCCACCTGCTGTAACTA No data
Right 925711842 2:6748653-6748675 AACTACGGCTTTGGTTGGACAGG No data
925711835_925711841 -10 Left 925711835 2:6748635-6748657 CCCTGTTCCACCTGCTGTAACTA No data
Right 925711841 2:6748648-6748670 GCTGTAACTACGGCTTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925711835 Original CRISPR TAGTTACAGCAGGTGGAACA GGG (reversed) Intergenic
No off target data available for this crispr