ID: 925711943

View in Genome Browser
Species Human (GRCh38)
Location 2:6749911-6749933
Sequence GGTTGGACAAAAATTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925711943_925711954 30 Left 925711943 2:6749911-6749933 CCTATAGGAATTTTTGTCCAACC No data
Right 925711954 2:6749964-6749986 CAGGGAGAATTATGGCCATGAGG No data
925711943_925711946 11 Left 925711943 2:6749911-6749933 CCTATAGGAATTTTTGTCCAACC No data
Right 925711946 2:6749945-6749967 AAGTCACTAAAACTCCCCCCAGG No data
925711943_925711947 12 Left 925711943 2:6749911-6749933 CCTATAGGAATTTTTGTCCAACC No data
Right 925711947 2:6749946-6749968 AGTCACTAAAACTCCCCCCAGGG No data
925711943_925711948 22 Left 925711943 2:6749911-6749933 CCTATAGGAATTTTTGTCCAACC No data
Right 925711948 2:6749956-6749978 ACTCCCCCCAGGGAGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925711943 Original CRISPR GGTTGGACAAAAATTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr