ID: 925717176

View in Genome Browser
Species Human (GRCh38)
Location 2:6795148-6795170
Sequence TGAGCTCTTCTCAGGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925717176_925717182 25 Left 925717176 2:6795148-6795170 CCTCATGGCCTGAGAAGAGCTCA No data
Right 925717182 2:6795196-6795218 TGAGAGAAGTTCAGCGCTGGAGG No data
925717176_925717181 22 Left 925717176 2:6795148-6795170 CCTCATGGCCTGAGAAGAGCTCA No data
Right 925717181 2:6795193-6795215 GAATGAGAGAAGTTCAGCGCTGG No data
925717176_925717183 26 Left 925717176 2:6795148-6795170 CCTCATGGCCTGAGAAGAGCTCA No data
Right 925717183 2:6795197-6795219 GAGAGAAGTTCAGCGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925717176 Original CRISPR TGAGCTCTTCTCAGGCCATG AGG (reversed) Intergenic
No off target data available for this crispr