ID: 925717560

View in Genome Browser
Species Human (GRCh38)
Location 2:6798258-6798280
Sequence CAGGAAAAGCAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925717549_925717560 16 Left 925717549 2:6798219-6798241 CCATGCCCATGATCCATTTTCCT No data
Right 925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG No data
925717550_925717560 11 Left 925717550 2:6798224-6798246 CCCATGATCCATTTTCCTGTCTG No data
Right 925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG No data
925717551_925717560 10 Left 925717551 2:6798225-6798247 CCATGATCCATTTTCCTGTCTGT No data
Right 925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG No data
925717553_925717560 -4 Left 925717553 2:6798239-6798261 CCTGTCTGTTCTCACTCCCCAGG No data
Right 925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG No data
925717552_925717560 3 Left 925717552 2:6798232-6798254 CCATTTTCCTGTCTGTTCTCACT No data
Right 925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925717560 Original CRISPR CAGGAAAAGCAAAATGAGGA GGG Intergenic
No off target data available for this crispr