ID: 925718264

View in Genome Browser
Species Human (GRCh38)
Location 2:6804631-6804653
Sequence TCTCCACTGCTCCTCAAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925718260_925718264 15 Left 925718260 2:6804593-6804615 CCACATAGCAGCGTGAAAACAGA No data
Right 925718264 2:6804631-6804653 TCTCCACTGCTCCTCAAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925718264 Original CRISPR TCTCCACTGCTCCTCAAGAC CGG Intergenic
No off target data available for this crispr