ID: 925718670

View in Genome Browser
Species Human (GRCh38)
Location 2:6807859-6807881
Sequence CTGGGGGTGTGGAGGTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925718670_925718687 14 Left 925718670 2:6807859-6807881 CCCCTTTACCTCCACACCCCCAG No data
Right 925718687 2:6807896-6807918 CCAACCTTGTTACCAAGATGAGG No data
925718670_925718688 15 Left 925718670 2:6807859-6807881 CCCCTTTACCTCCACACCCCCAG No data
Right 925718688 2:6807897-6807919 CAACCTTGTTACCAAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925718670 Original CRISPR CTGGGGGTGTGGAGGTAAAG GGG (reversed) Intergenic
No off target data available for this crispr