ID: 925720512

View in Genome Browser
Species Human (GRCh38)
Location 2:6822194-6822216
Sequence GTGGGGGTCCTGCTTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925720512_925720514 -9 Left 925720512 2:6822194-6822216 CCTCCATGAAGCAGGACCCCCAC No data
Right 925720514 2:6822208-6822230 GACCCCCACCCCATCCCGCCTGG No data
925720512_925720524 7 Left 925720512 2:6822194-6822216 CCTCCATGAAGCAGGACCCCCAC No data
Right 925720524 2:6822224-6822246 CGCCTGGAGCCATCACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925720512 Original CRISPR GTGGGGGTCCTGCTTCATGG AGG (reversed) Intergenic
No off target data available for this crispr